ID: 1077865459_1077865470

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1077865459 1077865470
Species Human (GRCh38) Human (GRCh38)
Location 11:6217982-6218004 11:6218034-6218056
Sequence CCAGGGCTGGAGGCGGGGGATGC CTGGAGACTCAGAGCCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 626} {0: 1, 1: 0, 2: 3, 3: 36, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!