ID: 1077887650_1077887653

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1077887650 1077887653
Species Human (GRCh38) Human (GRCh38)
Location 11:6397609-6397631 11:6397636-6397658
Sequence CCTTCAGGGCTCCAACTAGGTGC TAGGAAGCCATGCCTGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 73} {0: 1, 1: 0, 2: 3, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!