ID: 1077889766_1077889783

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1077889766 1077889783
Species Human (GRCh38) Human (GRCh38)
Location 11:6410755-6410777 11:6410800-6410822
Sequence CCATCTGTAAGGGCTTGGGGCCT AGGGGCTCAGGCAGCCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132} {0: 1, 1: 0, 2: 13, 3: 70, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!