ID: 1077889795_1077889810

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1077889795 1077889810
Species Human (GRCh38) Human (GRCh38)
Location 11:6410870-6410892 11:6410918-6410940
Sequence CCTCCTCGGCCTCCCCGGCCGCC GCTCTTGAGTGCTGATGATCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 203, 4: 2127} {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!