ID: 1077889797_1077889811

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1077889797 1077889811
Species Human (GRCh38) Human (GRCh38)
Location 11:6410879-6410901 11:6410923-6410945
Sequence CCTCCCCGGCCGCCTTCTCCTCT TGAGTGCTGATGATCAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 100, 4: 849} {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!