ID: 1077889801_1077889812

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1077889801 1077889812
Species Human (GRCh38) Human (GRCh38)
Location 11:6410888-6410910 11:6410933-6410955
Sequence CCGCCTTCTCCTCTCCCTCATCT TGATCAGGCCAGGTCCTCGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 54, 3: 748, 4: 4990} {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!