ID: 1077889805_1077889810

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1077889805 1077889810
Species Human (GRCh38) Human (GRCh38)
Location 11:6410902-6410924 11:6410918-6410940
Sequence CCCTCATCTGGCCCCTGCTCTTG GCTCTTGAGTGCTGATGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 438} {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!