ID: 1077909859_1077909869

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1077909859 1077909869
Species Human (GRCh38) Human (GRCh38)
Location 11:6564280-6564302 11:6564321-6564343
Sequence CCTGCACCCTCCTCACTGGCCTA CTTCCACTCCAGAAGCTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 332} {0: 1, 1: 0, 2: 1, 3: 52, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!