ID: 1077914425_1077914431

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1077914425 1077914431
Species Human (GRCh38) Human (GRCh38)
Location 11:6602040-6602062 11:6602067-6602089
Sequence CCTTTCTTCCCTACTTCAGCAGA CTGGCAAATGATGCCTTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 328} {0: 1, 1: 0, 2: 0, 3: 18, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!