ID: 1077922612_1077922617

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1077922612 1077922617
Species Human (GRCh38) Human (GRCh38)
Location 11:6653051-6653073 11:6653102-6653124
Sequence CCAATGATTTGGTGACTCTCCAT GTGGCCTCCTAGACCCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132} {0: 1, 1: 0, 2: 1, 3: 19, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!