ID: 1077930247_1077930250

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1077930247 1077930250
Species Human (GRCh38) Human (GRCh38)
Location 11:6723876-6723898 11:6723904-6723926
Sequence CCAGAGCTCAAGTATGAGGATGA TTCCCAGGACCACACAGAAGTGG
Strand - +
Off-target summary {0: 4, 1: 5, 2: 16, 3: 78, 4: 186} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!