|
Left Crispr |
Right Crispr |
| Crispr ID |
1077997364 |
1077997371 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:7465671-7465693
|
11:7465724-7465746
|
| Sequence |
CCCAGCTGTATTAGTCCATTTTC |
GGAAGAAAAAGAGGTTTAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 43, 2: 209, 3: 431, 4: 841} |
{0: 48, 1: 823, 2: 933, 3: 722, 4: 1767} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|