ID: 1078010478_1078010485

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1078010478 1078010485
Species Human (GRCh38) Human (GRCh38)
Location 11:7569638-7569660 11:7569687-7569709
Sequence CCTGCAGAGGAAGCATCAGGGAG CAGTGTTACCCTCAGGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 403} {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!