ID: 1078011084_1078011088

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1078011084 1078011088
Species Human (GRCh38) Human (GRCh38)
Location 11:7573710-7573732 11:7573728-7573750
Sequence CCCTTCTCAGCGGGCCCACTGTG CTGTGCACCATGTCTGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136} {0: 1, 1: 0, 2: 3, 3: 17, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!