ID: 1078025885_1078025891

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1078025885 1078025891
Species Human (GRCh38) Human (GRCh38)
Location 11:7695350-7695372 11:7695389-7695411
Sequence CCTCTCGACTCACTTGGAGGGGC CAGGGTGAACTCAGGGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58} {0: 1, 1: 0, 2: 0, 3: 21, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!