ID: 1078044256_1078044260

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1078044256 1078044260
Species Human (GRCh38) Human (GRCh38)
Location 11:7898961-7898983 11:7899014-7899036
Sequence CCTAGTGACCTTATTTTATCTTA ATAGTCACATTCTGAAAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 43, 3: 324, 4: 1260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!