ID: 1078059426_1078059438

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1078059426 1078059438
Species Human (GRCh38) Human (GRCh38)
Location 11:8033656-8033678 11:8033683-8033705
Sequence CCCCAACCCAGGGCCTGGCACGG GATGGCAGAGGTGTTTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 473} {0: 1, 1: 0, 2: 2, 3: 21, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!