ID: 1078061102_1078061106

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1078061102 1078061106
Species Human (GRCh38) Human (GRCh38)
Location 11:8045057-8045079 11:8045088-8045110
Sequence CCATTGGTGAGTGAACTCAATCT TCTCCTTTCCCCAGTGGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 26, 2: 58, 3: 65, 4: 132} {0: 1, 1: 0, 2: 2, 3: 47, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!