ID: 1078062609_1078062613

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1078062609 1078062613
Species Human (GRCh38) Human (GRCh38)
Location 11:8057769-8057791 11:8057790-8057812
Sequence CCTTCATTATTTTGTCATGCTTT TTAAGGCCCAGGAAAGGCCTAGG
Strand - +
Off-target summary {0: 34, 1: 63, 2: 71, 3: 136, 4: 671} {0: 58, 1: 118, 2: 121, 3: 88, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!