|
Left Crispr |
Right Crispr |
| Crispr ID |
1078062609 |
1078062618 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:8057769-8057791
|
11:8057806-8057828
|
| Sequence |
CCTTCATTATTTTGTCATGCTTT |
GCCTAGGCAAAACTCTTGGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 34, 1: 63, 2: 71, 3: 136, 4: 671} |
{0: 82, 1: 117, 2: 94, 3: 60, 4: 84} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|