ID: 1078066888_1078066898

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1078066888 1078066898
Species Human (GRCh38) Human (GRCh38)
Location 11:8084562-8084584 11:8084601-8084623
Sequence CCGTCCTCAGTGCCCTTGTCCTC TGCCTGGTGTTTCTCTCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 503} {0: 1, 1: 0, 2: 1, 3: 22, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!