ID: 1078071281_1078071283

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1078071281 1078071283
Species Human (GRCh38) Human (GRCh38)
Location 11:8113199-8113221 11:8113213-8113235
Sequence CCAGCCACTGAATGCTTAAAAGA CTTAAAAGAAGTCCATTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 178} {0: 1, 1: 0, 2: 2, 3: 16, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!