ID: 1078168501_1078168521

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1078168501 1078168521
Species Human (GRCh38) Human (GRCh38)
Location 11:8911077-8911099 11:8911126-8911148
Sequence CCGCCCCGCCTCCCCCACTTCTC CGCCAATGGCCCAGCTGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 23, 3: 174, 4: 1903} {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!