ID: 1078168511_1078168521

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1078168511 1078168521
Species Human (GRCh38) Human (GRCh38)
Location 11:8911100-8911122 11:8911126-8911148
Sequence CCGCCTCTCCCGCCTCTCCCGCC CGCCAATGGCCCAGCTGCGCCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 53, 3: 290, 4: 2206} {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!