ID: 1078168514_1078168521

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1078168514 1078168521
Species Human (GRCh38) Human (GRCh38)
Location 11:8911109-8911131 11:8911126-8911148
Sequence CCGCCTCTCCCGCCTTCCGCCAA CGCCAATGGCCCAGCTGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 354} {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!