ID: 1078172217_1078172225

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1078172217 1078172225
Species Human (GRCh38) Human (GRCh38)
Location 11:8936883-8936905 11:8936926-8936948
Sequence CCCGCCACCATGACCGGCTAATT CGGGGTTGACCGCATTAGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!