|
Left Crispr |
Right Crispr |
| Crispr ID |
1078178229 |
1078178232 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:8986990-8987012
|
11:8987021-8987043
|
| Sequence |
CCTGGGCAACACAGTGAGGCTCC |
AAACAAACAAAAGAAACTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 793, 2: 13092, 3: 53024, 4: 134466} |
{0: 1, 1: 2, 2: 52, 3: 549, 4: 4027} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|