ID: 1078178230_1078178234

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1078178230 1078178234
Species Human (GRCh38) Human (GRCh38)
Location 11:8987011-8987033 11:8987046-8987068
Sequence CCGCCACACAAAACAAACAAAAG AATTACCCTTATGATGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 216, 4: 2885} {0: 1, 1: 0, 2: 0, 3: 9, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!