ID: 1078182469_1078182473

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1078182469 1078182473
Species Human (GRCh38) Human (GRCh38)
Location 11:9023910-9023932 11:9023941-9023963
Sequence CCCGTCTGTAGCAGCCTCATGTG AAATGTGATTTCTATCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 128} {0: 1, 1: 0, 2: 3, 3: 24, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!