ID: 1078195959_1078195970

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1078195959 1078195970
Species Human (GRCh38) Human (GRCh38)
Location 11:9137402-9137424 11:9137446-9137468
Sequence CCAGTCCCTGAAATCACAGCCTG GTGCAGAAGCTGAGGCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 254} {0: 1, 1: 0, 2: 8, 3: 64, 4: 587}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!