ID: 1078210220_1078210232

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1078210220 1078210232
Species Human (GRCh38) Human (GRCh38)
Location 11:9264788-9264810 11:9264820-9264842
Sequence CCTCATCCGTTTCCCCCCTCCAG CCCTTCGCCCGCGCCCGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 275} {0: 1, 1: 0, 2: 4, 3: 37, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!