ID: 1078210382_1078210392

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1078210382 1078210392
Species Human (GRCh38) Human (GRCh38)
Location 11:9265288-9265310 11:9265329-9265351
Sequence CCCTCCGCGCCGCCGCCGCTGCA GGCCCGAGCGAGCCTGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 91, 4: 694} {0: 1, 1: 0, 2: 2, 3: 14, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!