|
Left Crispr |
Right Crispr |
| Crispr ID |
1078278962 |
1078278964 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:9880052-9880074
|
11:9880098-9880120
|
| Sequence |
CCAGCCTGGACAATGAGTGAGAC |
AAAAAAAAAAAAAAGATCTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 33, 2: 167, 3: 1115, 4: 8447} |
{0: 4, 1: 201, 2: 1930, 3: 12941, 4: 57923} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|