ID: 1078355328_1078355334

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1078355328 1078355334
Species Human (GRCh38) Human (GRCh38)
Location 11:10628283-10628305 11:10628301-10628323
Sequence CCTGGCCCCGACCTGAGCGTGCC GTGCCCTGCCGCACTGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142} {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!