ID: 1078357967_1078357973

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1078357967 1078357973
Species Human (GRCh38) Human (GRCh38)
Location 11:10647015-10647037 11:10647031-10647053
Sequence CCACGAGCTTGTGCTCCTGAGGG CTGAGGGGCTGGCAGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116} {0: 1, 1: 1, 2: 9, 3: 102, 4: 790}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!