ID: 1078417864_1078417873

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1078417864 1078417873
Species Human (GRCh38) Human (GRCh38)
Location 11:11180489-11180511 11:11180506-11180528
Sequence CCACAGCCCCCGCGGACAACCAT AACCATCCTGGAAAGGTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!