ID: 1078432945_1078432957

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1078432945 1078432957
Species Human (GRCh38) Human (GRCh38)
Location 11:11301749-11301771 11:11301779-11301801
Sequence CCTCTTTGCCTCTCGGGTGCCAG CTGGGCATTGGGAAAGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156} {0: 1, 1: 0, 2: 4, 3: 41, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!