ID: 1078453029_1078453043

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1078453029 1078453043
Species Human (GRCh38) Human (GRCh38)
Location 11:11454399-11454421 11:11454452-11454474
Sequence CCCAAGTATCCAGAATAGGACTG GAGAAGGAAGATAAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 129} {0: 1, 1: 2, 2: 37, 3: 719, 4: 4794}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!