ID: 1078453030_1078453041

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1078453030 1078453041
Species Human (GRCh38) Human (GRCh38)
Location 11:11454400-11454422 11:11454448-11454470
Sequence CCAAGTATCCAGAATAGGACTGT TAGGGAGAAGGAAGATAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126} {0: 1, 1: 0, 2: 9, 3: 110, 4: 1199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!