ID: 1078459194_1078459200

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1078459194 1078459200
Species Human (GRCh38) Human (GRCh38)
Location 11:11500475-11500497 11:11500512-11500534
Sequence CCATGTCTGGAGATGTTTTTGGT GGGTGGATGGAGATGCGCCATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 32, 3: 91, 4: 354} {0: 1, 1: 0, 2: 0, 3: 12, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!