ID: 1078460593_1078460603

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1078460593 1078460603
Species Human (GRCh38) Human (GRCh38)
Location 11:11512310-11512332 11:11512356-11512378
Sequence CCCATCTCACAGCTGTCAGACTC GGACAGACTGTTTTTCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 192} {0: 1, 1: 0, 2: 0, 3: 16, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!