ID: 1078466770_1078466780

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1078466770 1078466780
Species Human (GRCh38) Human (GRCh38)
Location 11:11555775-11555797 11:11555826-11555848
Sequence CCATGACCAGGTGGAATAGCCTG TGGACTCTGTCTCAAAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 102} {0: 1, 1: 0, 2: 0, 3: 40, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!