ID: 1078469225_1078469233

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1078469225 1078469233
Species Human (GRCh38) Human (GRCh38)
Location 11:11573742-11573764 11:11573793-11573815
Sequence CCTCATCATGGTCTCAATAAACC CGACGGTGACTTCCCGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174} {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!