ID: 1078490567_1078490571 |
View in Genome Browser |
Spacer: 3 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1078490567 | 1078490571 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:11764186-11764208 | 11:11764212-11764234 |
Sequence | CCATAGATCCTCATATTCTCCCT | TAAGCTTCACACTCAGAGCCTGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |