ID: 1078507440_1078507444

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1078507440 1078507444
Species Human (GRCh38) Human (GRCh38)
Location 11:11962924-11962946 11:11962964-11962986
Sequence CCAAAAATAGTTAAGATTTCTAA AGAGGTGTGCTTCAGTTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 553} {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!