ID: 1078510990_1078510995

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1078510990 1078510995
Species Human (GRCh38) Human (GRCh38)
Location 11:11983821-11983843 11:11983866-11983888
Sequence CCGACCCAATGCCTATACAACAA AACCTTCAGTTTCTTCAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 319} {0: 1, 1: 0, 2: 2, 3: 37, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!