ID: 1078527228_1078527232

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1078527228 1078527232
Species Human (GRCh38) Human (GRCh38)
Location 11:12110453-12110475 11:12110473-12110495
Sequence CCACGTGCGCCGGCGGCAGCGGC GGCGGTGACAGCCGGCCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 310} {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!