ID: 1078547935_1078547942

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1078547935 1078547942
Species Human (GRCh38) Human (GRCh38)
Location 11:12259825-12259847 11:12259864-12259886
Sequence CCTCGGAGAGACACTCCCACCGA GCCGCCATTGGCACCCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 53} {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!