ID: 1078549338_1078549347

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1078549338 1078549347
Species Human (GRCh38) Human (GRCh38)
Location 11:12269612-12269634 11:12269650-12269672
Sequence CCAGTGTCCAGGATGAGGGCTTC CAGCTCTGCTGAGGGCCGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!