ID: 1078550842_1078550848

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1078550842 1078550848
Species Human (GRCh38) Human (GRCh38)
Location 11:12279675-12279697 11:12279718-12279740
Sequence CCTGCCTCTCTCTCTGCTGCTTT CTGTCTCCACACATGGAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 142, 4: 1453} {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!